ASV Sequence GBOL_ASV_ID_54247

Date added 2022-08-02 06:12:02
Provided in projects: Project: DSUB-558 with original sequence id: P142690-19
Project: Introduction asv registry with original sequence id: P142690-2025-25
Project: Introduction asv registry with original sequence id: P142690-19
Primers
mlCOIintF, dgHCO2198

ACTTTCATCTAATATTGCCCATGGAGGAAGTTCTGTAGACTTAGCCATTTTTTCCCTTCATTTAGCTGGTATCTCCTCTATTTTAGGGGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAGATTATCCTTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGGGGAGACCCTATTCTTTATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Noctua_comes from ASV table 168 Arthropoda, Insecta, Lepidoptera, Noctuidae, Noctua, Noctua_comes 2025-12-03 13:23:57
Noctua_comes from ASV table 170 Arthropoda, Insecta, Lepidoptera, Noctuidae, Noctua, Noctua_comes 2025-12-04 23:59:38
Noctua comes Hübner, 1813 GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Noctuoidea, Noctuidae, Noctuinae, Noctua, Noctua, Noctua comes Hübner, 1813 100.0000 0E-8 2025-12-05 00:00:47

Occurrences Total of 6007 occurrences in 63 samples: ASV table 154 version 1 Download
Total of 1168 occurrences in 98 samples: ASV table 160 version 1 Download
Total of 989160 occurrences in 99 samples: ASV table 167 version 1 Download
Total of 1168 occurrences in 98 samples: ASV table 168 version 1 Download
Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download