ASV Sequence GBOL_ASV_ID_116741
| Date added | 2022-11-09 13:28:54 |
| Provided in projects: |
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_317 Project: Danish Reefs with original sequence id: COI_ASV_317 |
| Primers |
|
TTTATCAAGAAATATTGCGCATTCTGGTGGTTCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGTGTATCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGTTGGTATGGAATACAGTTTGAGCGACTTTCTCTTTTTGTTTGATCTGTAAAAATTACAGCTATTTTATTGCTTTTATCTCTTCCTGTTCTTGCTGGGGCTATTACTATATTATTGACTGATCGAAATTTTAATACCTCTTTCTTTGATCCTGCTGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Oerstedia dorsalis Abildgaard, 1806 | BOLD | Nemertea, Hoplonemertea, Monostilifera, Oerstediidae, Oerstedia, Oerstedia dorsalis Abildgaard, 1806 | 100.0000 | 2022-11-09 13:35:02 | |
| Oerstedia dorsalis | BOLDSYSTEMS | Animalia, Nemertea, Hoplonemertea, Monostilifera, Oerstediidae, Oerstedia, Oerstedia dorsalis | 100.0000 | 2026-11-05 11:47:23 |
| Occurrences |
Total of 213 occurrences in 61 samples:
ASV table 78 version 1 Download
Total of 213 occurrences in 61 samples: ASV table 78 version 2 Download Total of 213 occurrences in 61 samples: ASV table 78 version 3 Download Total of 213 occurrences in 60 samples: ASV table 42 version 5 Download |